POR siRNA

20-abx904141
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

POR siRNA

20-abx929282
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

POR siRNA

20-abx929283
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

POR antibody

10R-5360 100 ul
EUR 726.00
Description: Mouse monoclonal POR antibody

POR antibody

10R-5361 100 ul
EUR 691.00
Description: Mouse monoclonal POR antibody

POR antibody

10R-5362 100 ul
EUR 691.00
Description: Mouse monoclonal POR antibody

POR antibody

10R-5363 100 ul
EUR 691.00
Description: Mouse monoclonal POR antibody

POR antibody

10R-5365 100 ul
EUR 691.00
Description: Mouse monoclonal POR antibody

POR antibody

10R-5366 100 ul
EUR 691.00
Description: Mouse monoclonal POR antibody

POR antibody

10R-5367 100 ul
EUR 691.00
Description: Mouse monoclonal POR antibody

POR antibody

10R-5368 100 ul
EUR 691.00
Description: Mouse monoclonal POR antibody

POR Antibody

47179-100ul 100ul
EUR 252.00

POR Antibody

1-CSB-PA06275A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against POR. Recognizes POR from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

POR Polyclonal Antibody

A57874 100 µg
EUR 570.55
Description: The best epigenetics products

POR cloning plasmid

CSB-CL018378HU-10ug 10ug
EUR 682.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2043
  • Sequence: atgatcaacatgggagactcccacgtggacaccagctccaccgtgtccgaggcggtggccgaagaagtatctcttttcagcatgacggacatgattctgttttcgctcatcgtgggtctcctaacctactggttcctcttcagaaagaaaaaagaagaagtccccgagttcacca
  • Show more
Description: A cloning plasmid for the POR gene.