TUBE1 Antibody

45668-50ul 50ul
EUR 187.00

TUBE1 Antibody

ABD9034 100 ug
EUR 438.00

TUBE1 siRNA

20-abx938578
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TUBE1 siRNA

20-abx938579
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TUBE1 Antibody

DF9034 200ul
EUR 304.00
Description: TUBE1 Antibody detects endogenous levels of total TUBE1.

TUBE1 Conjugated Antibody

C45668 100ul
EUR 397.00

TUBE1 cloning plasmid

CSB-CL890909HU1-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1428
  • Sequence: atgacccagtcggtggtcgtacaggtcggccagtgcggaaaccagatcggctgctgcttctgggacctggcactaagggagcacgccgcggtcaaccagaaaggaatttatgatgaggcaataagcagcttctttagaaatgtggacaccagagtggttggtgatggtggaagta
  • Show more
Description: A cloning plasmid for the TUBE1 gene.

TUBE1 cloning plasmid

CSB-CL890909HU2-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1428
  • Sequence: atgacccagtcggtggtcgtacaggtcggccagtgcggaaaccagatcggctgctgcttctgggacctggcactaagggagcacgccgcggtcaaccagaaaggaatttatgatgaggcaataagcagcttctttagaaatgtggacaccagagtggttggtgatggtggaagta
  • Show more
Description: A cloning plasmid for the TUBE1 gene.

TUBE1 Blocking Peptide

DF9034-BP 1mg
EUR 195.00

Mouse TUBE1 shRNA Plasmid

20-abx977584
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human TUBE1 shRNA Plasmid

20-abx959583
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

TUBE1 Recombinant Protein (Mouse)

RP182270 100 ug Ask for price

TUBE1 Recombinant Protein (Rat)

RP235298 100 ug Ask for price

TUBE1 Recombinant Protein (Human)

RP033466 100 ug Ask for price

TUBE1 Recombinant Protein (Human)

RP033469 100 ug Ask for price