GCDH Antibody

47125-100ul 100ul
EUR 252.00

GCDH antibody

70R-2402 50 ug
EUR 467.00
Description: Rabbit polyclonal GCDH antibody raised against the N terminal of GCDH

GCDH antibody

70R-1103 100 ug
EUR 377.00
Description: Rabbit polyclonal GCDH antibody raised against the C terminal of GCDH

GCDH Antibody

DF12614 200ul
EUR 304.00
Description: GCDH Antibody detects endogenous levels of GCDH.

GCDH Conjugated Antibody

C47125 100ul
EUR 397.00

GCDH Polyclonal Antibody

A66898 100 µg
EUR 570.55
Description: Ask the seller for details

GCDH siRNA

20-abx917672
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GCDH siRNA

20-abx917673
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-GCDH

YF-PA11976 50 ul
EUR 363.00
Description: Mouse polyclonal to GCDH

anti-GCDH

YF-PA11977 50 ug
EUR 363.00
Description: Mouse polyclonal to GCDH

anti-GCDH

YF-PA11978 100 ug
EUR 403.00
Description: Rabbit polyclonal to GCDH

GCDH Antibody, HRP conjugated

1-CSB-PA849798LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GCDH. Recognizes GCDH from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

GCDH Antibody, FITC conjugated

1-CSB-PA849798LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GCDH. Recognizes GCDH from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

GCDH Antibody, Biotin conjugated

1-CSB-PA849798LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GCDH. Recognizes GCDH from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

GCDH cloning plasmid

CSB-CL849798HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1317
  • Sequence: atggccctgagaggcgtctccgtgcggctgctgagccgcggacccggcctgcacgtccttcgcacgtgggtctcgtcggcggcgcagaccgagaaaggcgggagaacacagagccaactggctaagtcctcgcgtcccgagtttgactggcaggacccgctggtgctggaggagc
  • Show more
Description: A cloning plasmid for the GCDH gene.